Transcription factor - PDFSEARCH.IO - Document Search Engine

Transcription factor
Results: 626

#	Item
331	Biological network inference: a challenge to structured data-mining Florence d’Alché-Buc1,2 1 Visiting: 2 Permanent Add to Reading List Source URL: www.egc.asso.fr Language: English Genetics Bioinformatics Systems biology Biological network inference Gene regulatory network Transcriptional regulation Transcription factor Gene Biology Gene expression Molecular biology
332	Table 1s. Primer sequences used for RT-PCR analyses. Gene Size Primer Sequence (5’ to 3’) ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg hABCG2-R ctgagctatagaggcctggg Add to Reading List Source URL: www.grc.nia.nih.gov Language: English - Date: 2007-10-11 22:01:00 RE1-silencing transcription factor Zinc finger Biology Transcription factors Gene expression
333	HIV-1 TAT Clade-B Human Immunodeficiency Virus 1 Trans-Acting Transcription factor recombinant, E. coli Cat. No. Add to Reading List Source URL: www.jenabioscience.com Language: English - Date: 2014-04-14 05:42:25 HIV Microbiology Virus Retrovirus Trans-activation response element Feline immunodeficiency virus HIV/AIDS Biology Tat
334	The Plant Journal[removed], 100–114 doi: [removed]j.1365-313X[removed]x An NAC transcription factor orchestrates multiple features of cell wall development in Medicago truncatula Add to Reading List Source URL: bioenergycenter.org Language: English - Date: 2010-09-17 09:10:00 Papermaking Plant physiology Polysaccharides Medicago truncatula Lignin Arabidopsis thaliana Meristem Cell wall Medicago Biology Model organisms Genomics
335	Functional characterization of the switchgrass (Panicum virgatum) R2R3MYB transcription factor PvMYB4 for improvement of lignocellulosic feedstocks Add to Reading List Source URL: bioenergycenter.org Language: English - Date: 2011-12-20 15:02:42 Genetics Transcription factors Gene expression Genomics Molecular biology Beta-galactosidase Ridge MYB Genetic engineering Flora of the United States Biology Flora
336	Available online http://arthritis-research.com/content/7/3/R526 Research article Open Access Add to Reading List Source URL: arthritis-research.com Language: English Programmed cell death Transcription factors NF-κB Tumor necrosis factor-alpha Chondrocyte Apoptosis Nitric oxide synthase Signal transduction Clusterin Biology Cell biology Cell signaling
337	The EMBO Journal[removed], 4479–4489 www.embojournal.org \|&[removed]European Molecular Biology Organization \| All Rights Reserved[removed] Add to Reading List Source URL: emboj.embopress.org Language: English - Date: 2015-02-10 14:08:29 Proteins Molecular biology Epigenetics FACT TATA-binding protein Transcription factor II A Nucleosome Point mutation Transcription factor Biology Gene expression Transcription factors
338	Genotype Protein Gene title Protein function and relevance Atf3[removed]] ATF3 activating transcription factor 3 transcription factor; negative regulator of TLR4 response [6] Crem[removed]] CREM cAMP responsive element m Add to Reading List Source URL: www.ncbi.nlm.nih.gov
339	ADNP (Human) Recombinant Protein (Q01) zinc finger domains, suggesting that it functions as a transcription factor. This gene is also upregulated in normal proliferative tissues. Finally, the encoded protein Add to Reading List Source URL: www.abnova.com Language: English - Date: 2013-07-15 21:26:41 Biochemistry Antioxidants Vasoactive intestinal peptide Peptide Glutathione Recombinant DNA Biology Chemistry Peptide hormones
340	Intestinal Tumorigenesis Initiated by Dedifferentiation and Acquisition of Stem-Cell-like Properties Sarah Schwitalla,1 Alexander A. Fingerle,2 Patrizia Cammareri,5 Tim Nebelsiek,1 Serkan I. Go¨ktuna,1 Paul K. Ziegler,1 Add to Reading List Source URL: openwetware.org Language: English - Date: 2013-01-28 13:47:07 Programmed cell death Transcription factors Stem cells Beta-catenin NF-κB Catenin Tumor necrosis factor-alpha Colorectal cancer IKK2 Biology Signal transduction Genes

UPDATE